Virtual Library
Start Your Search
R. Juergens
Moderator of
-
+
ORAL 03 - New Kinase Targets (ID 89)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 8
- Moderators:F. Blackhall, R. Juergens
- Coordinates: 9/07/2015, 10:45 - 12:15, Mile High Ballroom 4a-4f
-
+
- Abstract
- Presentation
Background:
Anlotinib is a multi-target RTK inhibitor, especially on VEGFR2/3, EGFR, c-Kit, PDGF, FDFR, c-MET, with highly selective inhibition effect. This phase II study was to investigate efficacy and safety of anlotinib in refractory NSCLC patients
Methods:
Patients ≥18 years with metastatic or recurrent advanced NSCLC and ECOG status of 0–1 were randomized 1:1 to receive Anlotinib or placebo (Anlotinib 12mg/day, po, day 1-14 each 3-week) until progression, unacceptable toxicity, withdrawal or death. Patients had received first and second line treatment for advanced NSCLC. Patients were stratified by gender, smoking status and age. We used RECIST (version 1.1) criteria to assess response and progression. Primary endpoint was PFS in ITT population; secondary endpoints included ORR, OS, biomarkers and safety.
Results:
From Aug. 2013 to May 2014, we enrolled 117 patients from 13 centers, including 60 patients to anlotinib arm and 57 patients to placebo. Baseline characteristics were similar in both treatment groups. PFS was prolonged with anlotinib 4.83 month vs placebo 1.23 months (HR 0.32, 95% CI 0.20–0.51, p<0.0001). ORR was improved with addition of anlotinib: 10% vs 0% with placebo (p<0.027).DCR was 83.3% with anlotinib vs 31.5% with placebo (p<0.0001). mOS was prolonged with Anlotinib 10.33 months vs placebo 6.3 months. (HR, 0.656; 95% CI, 0.411 to 1.048; P = 0.0776; Cutoff date: April 12, 2015. This mOS is an estimated data, OS events for both arms still not reach 75%). OS rate of >12 months is 22.8% in placebo arm and 38.3% in anlotinib arm. AEs occurred more frequently with anlotinib than placebo; the most common AEs of any grade were hypertension (53.33%), increased TSH (36.67%), hand foot syndrome (28.33%), increased TG (26.67%), increased TC (25%), cough (21.67%), diarrhea (21.67%), increased LDL (16.67%), hemoptysis (16.67%) oral mucositis (13.33%), and sore throat (13.33%). Grade III/IV treatment-related AEs increased 16.4% in anlotinib group (anlotinib: 21.6% , placebo: 5.3%, p=0.0140).
Conclusion:
This study confirms that anlotinib to third-line platinum-based chemotherapy appears to provide significant PFS benefits in Chinese patients with refractory advanced NSCLC compared with placebo. No serious safety concerns were reported in the study.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.02 - Is EGFR Exon20 Mutation a Prognostic/Predictive Biomarker in Our Lung Cancer Patients? (ID 2744)
10:45 - 12:15 | Author(s): D.S. Joy Philip, A. Choughule, N. Jambhekar, V. Patil, A. Joshi, V. Naronha, K. Prabhash
- Abstract
- Presentation
Background:
EGFR Exon20 mutations have been considered to be markers of acquired resistance to Tyrosine Kinase inhibitors. The association between Oral TKI response and Baseline Exon20 Mutations has not been addressed in many studies and remains to be evaluated.
Methods:
We conducted a retrospective audit of our prospectively maintained Lung cancer audit database in our institute in the year 2014.We reviewed data related to EGFR mutation testing by RQ-PCR using endpoint genotyping assay for EXON 20, 19, 21.We also reviewed data relating to baseline demographics,clinical profile, patient treatment and outcome measures in terms of response and survival.
Results:
We reviewed 807 sequentially tested lung cancer patients, who underwent molecular testing using RQ-PCR by endpoint genotyping assay. The overall mutation rate was 26.4% and 19 (2%) had baseline EGFR EXON20 mutation. The median age of patients was 56yrs [range: 29-81yrs], with 7 patients being females .There were 7 patients who gave past history of smoking. The most common site of metastasis was pleural effusion in 8,followed by Bone in 6,Brain in 5 and Liver metastasis in 2patients.Histology was adenocarcinoma in majority[16 patients].Among the types of EXON20 Mutations, 7 patients had S7681, 4 patients had INSGGT, 5patients had INS 9 and 4 patients had T790M mutation. All patients received chemotherapy as first line treatment. We have documented response assessment at 2months in 8 patients with progressive disease in 5[63%], stable disease in 2 and partial response in 1 patient. Second line therapy with Oral TKI was given to 9 patients, in whom we have documented response assessment in 6, all of whom had progressed.The median Overall survival of Exon-20 mutation positive patients was 5.5months. [Range of 3.8-7.2months], in comparison with other types of EGFR mutations which showed median Overall survival of 16.3months[range:12.7-19.4months
Conclusion:
EXON-20 Mutations in general proclaim grave prognosis, predicting limited benefit of chemotherapy and marked TKI resistance.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.03 - EGFR Exon 18 Mutations in Lung Cancer: Molecular Predictors of Sensitivity to Afatinib or Neratinib but Not to Other EGFR-TKIs (ID 1748)
10:45 - 12:15 | Author(s): Y. Kobayashi, Y. Togashi, Y. Yatabe, H. Mizuuchi, P. Jangchul, C. Kondo, M. Shimoji, K. Sato, K. Suda, K. Tomizawa, T. Takemoto, T. Hida, K. Nishio, T. Mitsudomi
- Abstract
- Presentation
Background:
Lung cancers harboring common EGFR mutations respond to EGFR tyrosine kinase inhibitors (TKIs),whereas exon 20 insertions (Ins20) are known to be resistant to these drugs. However, little is known about the role of mutations in exon 18. Inspired by clinical observation that a patient with adenocarcinoma harboring exon 18 deletion (Del18: delE709_T710insD) responded to afatinib, this study aimed to establish a rational therapeutic strategy for lung cancers harboring exon 18 mutations.
Methods:
The mutational status of lung cancers registered in Aichi Cancer Center (ACC) database between 2001 and 2015 was reviewed. Three representative mutations in exon 18, Del18, E709K, and G719A, were introduced into Ba/F3, NIH3T3, and HEK293 cells using retroviral vector. The 90% inhibitory concentrations (IC90s) of first generation (1G) (gefitinib and erlotinib), second generation (2G) (afatinib, dacomitinib, and neratinib), and third generation (3G) TKIs (AZD9291 and CO1686) in these cells were determined and compared with the corresponding IC90s in cells expressing exon 19 deletion (Del 19) and with the trough concentration (C~trough~) at the recommended doses for each drug. Clinical data on the treatment response of tumors harboring exon 18 mutations were collected from the ACC and Catalogue of Somatic Mutations in Cancer (COSMIC) databases.
Results:
Among the 1355 EGFR mutations registered in the ACC database, Del19, L858R, and Ins20 were detected in 40%, 47%, and 4%, respectively. Of note, exon 18 mutations including G719X, E709X, and Del18 were present in 3.2% (n=43), accounting for 38% of the remaining. According to the COSMIC database, exon 18 mutations accounted for 4.1% (654/16,138) of all EGFR mutations present from exons 18-21. Mutations at codons 709 and 719 accounted for 84% of all exon 18 mutations. Ba/F3 cells expressing Del18, E709K, or G719A grew in the absence of interleukin 3, and NIH3T3 cells transfected with these mutations formed foci with marked pile-up, indicating that these mutations act as oncogenic drivers. IC90s of 1G and 3G TKIs in cells transfected with Del18, E709K and G719A were much higher than those in cells transfected with Del19 (by >50-, >25-, and >11-fold, respectively). In contrast, IC90 of afatinib in these three mutations ranged from only 2- to 6-fold greater than that in Del19 and was <1/40 of its C~trough~. Notably, cells transfected with exon 18 mutations exhibited higher sensitivity to neratinib (by 25-fold for E709K, by 5-fold for G719A, and by a comparable extent for Del 18) than those expressing Del19. Western blot analyses showed that these differential sensitivities corresponded to different degrees of suppression of EGFR phosphorylation in HEK293 cells. Furthermore, analyses of the ACC and COSMIC databases clearly indicated that patients with lung cancers harboring G719X exhibited higher response rate to afatinib or neratinib (~80%) than to 1G TKIs (35-56%).
Conclusion:
Our data indicated that lung cancers harboring exon 18 mutations, although rare, should not be overlooked in clinical practice and that these cases are best treated with afatinib or neratinib, although the currently available in vitro diagnostic kits do not detect all exon 18 mutations.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.04 - Discussant for ORAL03.01, ORAL03.02, ORAL03.03 (ID 3292)
10:45 - 12:15 | Author(s): H. West
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.05 - Clinical Outcomes with Pemetrexed-Based Systemic Therapy in RET-Rearranged Lung Cancers (ID 2813)
10:45 - 12:15 | Author(s): A. Drilon, I. Bergagnini, L. Delasos, C.S. Sima, R. Smith, R. Somwar, G.J. Riely, M.G. Kris
- Abstract
- Presentation
Background:
Previous series have shown that clinical benefit with pemetrexed-based systemic therapy can be durable in patients with ALK- and ROS1-rearranged lung cancers. The benefit of pemetrexed-based treatment in RET-rearranged lung cancers relative to other genomic subsets has not been explored.
Methods:
A retrospective review of records of patients treated at Memorial Sloan Kettering between 2007-2014 was conducted. Eligibility criteria: pathologically-confirmed advanced (stage IIIB/IV) non-small cell lung carcinoma, treatment with pemetrexed as monotherapy or in combination with other systemic agents, documented evidence of a rearrangement involving RET, ROS1, or ALK, or a KRAS mutation. Screening for these alterations was performed via break apart fluorescence in situ hybridization, multiplex mutation hotspot testing (Sequenom), or next-generation sequencing (MSK-IMPACT, Illumina HiSeq). Progression-free survival (PFS) and time to progression (TTP) were calculated using Kaplan-Meier estimates from the date of initiation of pemetrexed-containing therapy, and overall survival (OS) from diagnosis of metastatic disease. Overall response rate (ORR, RECIST v1.1), PFS, TTP, and OS were compared between RET-rearranged lung cancers and control groups (ALK- and ROS1-rearranged and KRAS-mutant lung cancers).
Results:
Data from 104 patients (RET-rearranged n=17, ROS1-rearranged n=10, ALK-rearranged n=36, KRAS-mutant n=41) were evaluated. As expected, median pack-year cigarette smoking history significantly differed between groups (p<0.001): RET 0 (0-48 range), ROS1 0 (0-12), ALK 0 (0-74), KRAS 38 (0-93). Features such as line of pemetrexed therapy (first vs other, p=0.1186), type of therapy (platinum combination, non-platinum combination, vs single-agent, p=0.1435), and need for dose reduction (p=0.9772) did not differ between groups. ORR, TTP, PFS, and OS in RET-rearranged lung cancers were not significantly different compared to ALK- and ROS1-rearranged lung cancers, and improved compared to KRAS-mutant lung cancers (Table 1). Table 1. Clinical Outcomes of Pemetrexed-Based TherapyRET ROS1 ALK KRAS p-value ORR 45% 78% 50% 26% 0.0242 Median TTP (months) NR (20-NR) 32 (14-NR) NR 7 (5-14) <0.001 ALK vs ROS1 vs RET (p=0.90); RET vs KRAS(p=0.009) Median PFS 20 (10-NR) 23 (14-NR) 24 (15-38) 6 (5-9) <0.001 ALK vs ROS1 vs RET (p=0.94); RET vs KRAS(p=0.002) Median OS NR (24-NR) NR (24- NR) 37 (30-63) 16 (13-29) <0.001 ALK vs ROS1 vs RET (p=0.43); RET vs KRAS(p=0.002)
Conclusion:
Clinical benefit with pemetrexed-based therapy in RET-rearranged lung cancers can be durable and is comparable to ALK- and ROS1-rearranged lung cancers. Outcomes in RET-, ROS1-, and ALK-rearranged lung cancers were improved compared to KRAS-mutant lung cancers. Mechanisms responsible for pemetrexed sensitivity in these subsets should continue to be explored. Driver-independent factors such as smoking history may contribute to clinical benefit.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.06 - Activity of Crizotinib in MET Amplified NSCLC: Preliminary Results of the AcSé Trial (ID 1200)
10:45 - 12:15 | Author(s): D. Moro-Sibilot, M. Le Deley, G. Zalcman, S. Bota, R. Sabatier, P.J. Souquet, L. Favier, M. Poudenx, P. Bombaron, C. Audigier-Valette, P. Bernard, P. Foucher, N. Girard, J. Merlio, L. Arnould, G. Ferretti, T. Mortier, E. Lonchamp, G. Vassal, C. Mahier - Ait Oukhatar
- Abstract
- Presentation
Background:
Crizotinib (crz) is registered only for the treatment of patients (pts) with ALK-translocated lung cancer. Crz is also a MET inhibitor. MET is amplified in several malignancies. Activity of crz in MET amplified (+) tumors was explored as part of the French National Cancer Institute (INCa) AcSé program, including both access to tumor molecular diagnosis and an exploratory multi-tumor 2-stage design phase II trial. We report here results in pts with MET + NSCLC.
Methods:
MET analysis on formalin-fixed, paraffin-embedded tumor samples was proposed in 170 investigating centers and performed in 28 regional INCa molecular genetic centers. MET+ was explored by FISH in tumor samples showing an IHC score of ≥2+. Pts with a tumor showing > 6 MET copies, whatever the MET/CEN7 ratio, were eligible, providing they were not eligible for any other academic or industry trial evaluating another MET inhibitor. Study treatment consisted in crz 250 mg BID. The objective response rate (ORR) and disease control rate (DCR) were assessed every 8 weeks, using RECIST v1.1.
Results:
From Aug. 5, 2013 to Mar. 1, 2015, 25 pts with MET+ NSCLC were enrolled and received crz. Median age was 59 years (range 30–92). Forty-four percent were females, 92% had tumors of non-squamous histology, and 96% presented with metastatic disease at study entry. Median number of prior treatments was 2 (range 0 – 11). Eight pts were still on treatment at the cut-off date, 17 have stopped crz (15 progressive diseases (PD), 1 adverse event (AE), 1 patient’s choice). Among the 18 pts evaluable for response after 8 weeks, we observed 7 partial responses, 6 stable diseases and 5 PD, leading to an ORR of 39% [95% CI:17-64], and a DCR of72% [47-90]. DCR at 6 months was 22% (4 pts out of the 18 evaluable pts). Crz was well tolerated with only 5 grade ≥3 (2 AE + 3 SAEs) and 3 grade 1-2 SAEs. Most common AEs, mainly grade 1 or 2, were nausea (60% of pts), visual disorders (52%), anemia (52%), elevated transaminases (48%) and vomiting (40%).
Conclusion:
Nationwide biomarker-driven access to crz for pts with MET+ malignancy is feasible. Crz was well tolerated and showed responses in pretreated MET+ lung cancers. Survival data and duration of response will be presented.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)
10:45 - 12:15 | Author(s): P. Paik, A. Drilon, H. Yu, N. Rekhtman, L. Borsu, M. Ginsberg, M. Berger, M. Ladanyi, C.M. Rudin
- Abstract
- Presentation
Background:
Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.
Methods:
Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.
Results:
Clinicopathologic data for those treated (N=4) are in the table below:
To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score) 1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA 2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300 3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA 4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
Conclusion:
MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
-
+
ORAL03.08 - Discussant for ORAL03.05, ORAL03.06, ORAL03.07 (ID 3293)
10:45 - 12:15 | Author(s): R. Salgia
- Abstract
- Presentation
Abstract not provided
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
Author of
-
+
ORAL 02 - PD1 Axis Immunotherapy 2 (ID 87)
- Event: WCLC 2015
- Type: Oral Session
- Track: Treatment of Advanced Diseases - NSCLC
- Presentations: 1
- Moderators:E.B. Garon, H.J. Ross
- Coordinates: 9/07/2015, 10:45 - 12:15, Four Seasons Ballroom F1+F2
-
+
ORAL02.05 - Safety and Efficacy of First-Line Nivolumab (NIVO; Anti-Programmed Death-1 [PD-1]) and Ipilimumab in Non-Small Cell Lung Cancer (NSCLC) (ID 786)
10:45 - 12:15 | Author(s): R. Juergens
- Abstract
- Presentation
Background:
Combined blockade of the PD‐1 and cytotoxic T‐lymphocyte‐associated antigen‐4 (CTLA‐4) immune checkpoint pathways has shown improved responses, encouraging survival rates, and a manageable safety profile in advanced melanoma. NIVO, a fully human IgG4 PD-1 immune checkpoint inhibitor antibody, has activity across NSCLC histologies and is approved in the US for treatment of metastatic squamous (SQ) NSCLC with progression on or after platinum-based chemotherapy. This phase 1 study evaluated the safety and efficacy of first‐line therapy with NIVO plus ipilimumab (IPI), an IgG1 CTLA‐4 checkpoint receptor blocking antibody, in chemotherapy‐naïve patients with advanced NSCLC.
Methods:
Patients (N=49) received NIVO plus IPI at the 1+3 mg/kg or 3+1 mg/kg combination dose, respectively (one SQ and one non‐SQ cohort per dose level), every 3 weeks for 4 cycles, followed by NIVO 3 mg/kg every 2 weeks until progression or unacceptable toxicity. Objective response rate (ORR; RECIST v1.1) was evaluated overall and by baseline tumor PD‐1 ligand 1 (PD‐L1) expression (PD‐L1[+]: ≥5% tumor cells expressing PD‐L1). Response was assessed at weeks 10, 17, and 23, and every 3 months thereafter until progression.
Results:
Median follow‐up for all patients was 50 weeks. Across histologies, confirmed ORR was 13% (3/24) for NIVO1+IPI3 and 20% (5/25) for NIVO3+IPI1. Two of 3 and 4/5 responders in the NIVO1+IPI3 and NIVO3+IPI1 arms, respectively, achieved a response by first scan. Median duration of response was not reached (NR) in either group, and responses were ongoing in 67% (2/3) and 60% (3/5) of patients treated with NIVO1+IPI3 and NIVO3+IPI1, respectively. Two patients in the NIVO3+IPI1 group exhibited an unconventional “immune-related” response with 56% and 64% maximum reductions in target lesions and simultaneous appearance of new lesions. The 24-week progression-free survival (PFS) rates and median PFS were 44% and 16.1 weeks, respectively, for NIVO1+IPI3 and 33% and 14.4 weeks, respectively, for NIVO3+IPI1. One-year overall survival (OS) rates and median OS were 65% and NR, respectively, for NIVO1+IPI3 and 44% and 47.9 weeks, respectively, for NIVO3+IPI1. Thirty-eight of 49 treated patients were evaluable for PD-L1 expression; objective responses were observed in PD‐L1[+] (19%, 3/16) and PD‐L1[-] (14%; 3/22) patients. Across arms, grade 3–4 treatment-related adverse events (AEs) were reported in 25 patients (51%); grade 3 pneumonitis was reported in 3 (6%) patients. Treatment‐related AEs led to discontinuation in 18 patients (37%); 15 (31%) patients discontinued treatment during induction. Treatment‐related deaths (n=3) were due to respiratory failure, bronchopulmonary hemorrhage, and toxic epidermal necrosis.
Conclusion:
Treatment with NIVO plus IPI was associated with durable responses and encouraging survival regardless of tumor PD-L1 expression. The safety profile was managed using established safety guidelines. Updated OS and results from additional doses and schedules will be presented.
Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.
