Virtual Library

 x 
My Library Virtual Library FAQ

Start Your Search

P. Paik



Author of

  • +

    ED 07 - How to Treat Advanced Squamous Carcinoma of the Lung (ID 7)

    • Event: WCLC 2015
    • Type: Education Session
    • Track: Treatment of Advanced Diseases - NSCLC
    • Presentations: 1
    • +

      ED07.04 - Targeting Gene Amplification in Squamous Cancer (ID 1801)

      14:15 - 15:45  |  Author(s): P. Paik

      • Abstract
      • Presentation
      • Slides

      Abstract:
      Copy number alterations are common events in squamous cell lung cancers. A number of these play defined roles in tumorigenesis. Some are known to be oncogenic drivers in a subset of cases. Broad high-level amplification of the 3q26-28 cytoband occurs in about 30% of squamous cell lung cancers and was one of the first recurrent alterations characterized in this disease.(1) More focal amplification of 8p11 occurs between 10-20% of tumors.(2, 3) Specific genes in 3q26 that are recurrently amplified include SOX2, PIK3CA, and PRKCI. Other genes commonly amplified in 3q27-28 include BCL6, TP63, and EPHB3. Genes that are amplified at lower frequencies include EGFR, MYC, MCL1, RICTOR, CCND1, and CDK6. The table below summarizes these alterations.

      Gene Chromosome Frequency
      SOX2 3q26 35%
      PIK3CA 3q26 30%
      BCL6 3q27 20%
      PRKCI 3q26 25%
      TP63 3q28 21%
      FGFR1 8p11 12%
      MYC 8q24 8%
      MCL1 1q21 6%
      RICTOR 5p13 6%
      EGFR 7p12 5%
      CCND1 11q13 10%
      CDK6 7q21-22 3%
      Pharmacologic targeting of gene amplification events in squamous cell lung cancers has centered largely on 4 genes- FGFR1, PIK3CA, CCND1, and CDK6. The pre-clinical data and clinical trial work defining FGFR1 amplification as an oncogenic driver and drug target, respectively, are the most mature. Three abstracts summarizing the preliminary efficacy of the pan-FGFR inhibitors AZD4547, BGJ398, and JNJ42756493 were presented in 2014.(4-6) The overall response rates were low, ranging from 8-15%. Some of these have continued on as phase 2 trials (NCT02154490, AD4547). Other studies using less-specific FGFR inhibitors are also ongoing (NCT01935336, ponatinib; NCT02109016, lucitanib). Upstream PI3K pathway alterations have been the therapeutic targets for a number of trials of PI3K inhibitors, though only a subset have included PIK3CA amplification as a biomarker of interest. These include two phase 1 trials of PI3K-α or PI3K/mTOR inhibitors that have added expansion arms for PIK3CA amplified squamous cell lung cancers (NCT01296555, GDC0032; NCT01655225, LY3023414). Data for these studies have not yet been presented. Finally, G1/S checkpoint inhibitors, whose efficacy has been best defined in breast cancer, are now being tested for CCDN1 and CDK4/6 amplified squamous cell lung cancers. Drugs include palbociclib (S1400, NCT02154490) and abemaciclib (NCT02450539). It is worth noting, however, that the pre-clinical rationale for targeting the G1/S checkpoint alone is substantially weaker than for other pathways. The clinical experience derived from targeting FGFR1 amplification in squamous cell lung cancers can serve as a framework to understand, in general, which targeted therapy strategies are likely to fail both now and in the future. Comprehensive genomic analyses of squamous cell lung cancers have shown that these tumors are complex, with overlapping alterations in more than one oncogene and/or tumor suppressor occurring in most cases. This is particularly problematic for gene amplification targets, which are also plagued by questions of functional relevance apropos degree of amplification and association with protein expression. As borne out in the phase 1 trials of the pan-FGFR inhibitors, single-target inhibition is unlikely to generate the breadth and depth of responses seen with other drugs targeting other oncogenes. Issues surrounding pharmacodynamic efficacy and target inhibition may also play a role in limiting responses. Data from ongoing work will be presented identifying potential genomic and non-genomic modifiers of response to FGFR1 inhibition. References 1. Björkqvist A-M, Husgafvel-Pursiainen K, Anttila S, Karjalainen A, Tammilehto L, Mattson K, et al. DNA gains in 3q occur frequently in squamous cell carcinoma of the lung, but not in adenocarcinoma. Genes, Chromosomes and Cancer. 1998;22:79-82. 2. Paik PK, Shen R, Won H, Rekhtman N, Wang L, Sima CS, et al. Next generation sequencing of stage IV squamous cell lung cancers reveals an association of PI3K aberrations and evidence of clonal heterogeneity in patients with brain metastases. Cancer Discovery. 2015. 3. TCGA. Comprehensive genomic characterization of squamous cell lung cancers. Nature. 2012;489(7417):519-25. 4. Paik P, Shen R, Ferry D, Soria J-C, Mathewson A, Kilgour E, et al. A phase 1b open-label multicenter study of AZD4547 in patients with advanced squamous cell lung cancers: Preliminary antitumor activity and pharmacodynamic data. J Clin Oncol. 2014;32:suppl; abstr 8035. 5. Nogova L, Sequist L, Cassier P, Hidalgo M, Delord J-P, Schuler M, et al. Targeting FGFR1-amplified lung squamous cell carcinoma with the selective pan-FGFR inhibitor BGJ398. J Clin Oncol. 2014;32:suppl; abstr 8034. 6. Bahleda R, Dienstemann R, Adamo B, Gazzah A, Infante J, Zhong B. Phase 1 study of JNJ-42756493, a pan-fibroblast growth factor receptor (FGFR) inhibitor, in patients with advanced solid tumors. J Clin Oncol. 2014;32:abstr 2501.

      Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.

      Only Active Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login or select "Add to Cart" and proceed to checkout.

  • +

    MINI 16 - EGFR Mutant Lung Cancer 2 (ID 130)

    • Event: WCLC 2015
    • Type: Mini Oral
    • Track: Treatment of Advanced Diseases - NSCLC
    • Presentations: 1
    • +

      MINI16.14 - A Phase 1 Study of Erlotinib and Ruxolitinib in Patients with EGFR-Mutant Lung Cancers and Acquired Resistance to Erlotinib Therapy (ID 2818)

      16:45 - 18:15  |  Author(s): P. Paik

      • Abstract
      • Presentation
      • Slides

      Background:
      Patients with EGFR-mutant lung cancers treated with EGFR tyrosine kinase inhibitors (TKI) develop clinical resistance, often associated with acquisition of EGFR T790M. Upregulation of JAK/STAT signaling is involved in resistance to EGFR TKIs and JAK inhibition is a proposed treatment strategy in the setting of acquired resistance by restoring sensitivity to erlotinib. Ruxolitinib is an FDA-approved oral JAK1/2 inhibitor given at 20mg twice daily for hematologic malignancies with a largely non-overlapping toxicity profile with erlotinib.

      Methods:
      We evaluated the toxicity and efficacy of once daily oral erlotinib and twice daily oral ruxolitinib in patients with EGFR-mutant lung cancers and acquired resistance to erlotinib therapy (NCT02155465). Using a 3+3 dose escalation, we assessed escalating doses of ruxolitinib (10mg BID, 15mg BID, 20mg BID) with erlotinib 150mg daily for 21 day cycles. Response was evaluated by RECIST 1.1. Tissue and peripheral blood samples were obtained; exosomes will be extracted from peripheral blood and molecular and proteomic analyses will be performed.

      Results:
      From May 2014 to February 2015, 12 patients (pts) were enrolled. Median age: 60; Women: 7 (58%); never-smokers: 6 (50%); EGFR L858R=4 (33%) and Exon 19 deletion=8 (67%). Two of twelve (17%) were EGFR T790M positive at rebiopsy at the time of acquired resistance. Of 12 pts treated, 3 received ruxolitinib 10mg BID, 3 received 15mg bid and 6 received 20mg BID with erlotinib 150mg daily. No dose limiting toxicities were seen. The recommended phase 2 dose is ruxolitinib 20mg BID with 150mg erlotinib daily. Treatment-related AEs were all grade 1-3. The most frequent treatment related clinical adverse events (all grade 1-3) were anemia (25%), diarrhea (25%), rash (25%), pain (17%), fatigue (8%), and pneumonitis (8%). The most frequent treatment-related laboratory adverse events (all grade 1-2) were anemia (33%), elevated ALT (17%), elevated AST (17%), and hyperbilirubinemia (8%). Of the 12 pts treated, 2 (17%) required a dose reduction of erlotinib for treatment emergent toxicities; both subjects were on lower doses of erlotinib than 150mg daily prior to study enrollment. There were no dose reductions of ruxolitinib. Of 12 evaluable patients, no partial responses were seen. The median-progression free survival is 3 months. Two patients remain on study. One patient has been on study for 10 months with ongoing stable disease. Nine patients (75%) came off study for progression, 1 (8%) for toxicity. One person discontinued treatment on study for grade 3 pneumonitis, possibly related to the combination of erlotinib and ruxolitinib. The symptoms resolved with discontinuation of erlotinib and ruxolitinib.

      Conclusion:
      Combination erlotinib and ruxolitinib is well-tolerated. The phase 2 dose of ruxolitinib is 20mg BID in combination with erlotinib. There were no partial responses, but durable disease control was seen in some patients. The phase 2 study of erlotinib and ruxolitinib in this population is ongoing.

      Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.

      Only Active Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login or select "Add to Cart" and proceed to checkout.

  • +

    MINI 38 - Biology and Prognosis (ID 167)

    • Event: WCLC 2015
    • Type: Mini Oral
    • Track: Thymoma, Mesothelioma and Other Thoracic Malignancies
    • Presentations: 1
    • +

      MINI38.06 - FP1039/GSK3052230 with Chemotherapy in Patients with Fibroblast Growth Factor (FGF) Pathway Deregulated Squamous NSCLC or MPM (ID 2879)

      18:30 - 20:00  |  Author(s): P. Paik

      • Abstract
      • Presentation
      • Slides

      Background:
      GSK3052230/FP1039 is a soluble fusion protein with the ECD of FGFR1c linked to the hinge and Fc regions of human IgG1 and acts as a ligand trap by sequestering FGFs involved in tumor growth and angiogenesis. In contrast to small molecule FGFR kinase inhibitors, GSK3052230 spares the hormonal FGF ligands, namely FGF19, 21 and 23. GSK3052230 combined with chemotherapy was efficacious in xenograft models of FGFR1-amplified NSCLC and malignant pleural mesothelioma (MPM) with FGF2 mRNA overexpression. A phase I monotherapy study determined 20mg/kg weekly as the maximum feasible dose (MFD) achieving the desired blood concentration, with no maximum tolerated dose (MTD) reached.

      Methods:
      This study (NCT01868022 funded by GSK) will evaluate the safety and efficacy of GSK3052230 weekly infusion in combination with paclitaxel + carboplatin in previously untreated FGFR1 amplified metastatic sqNSCLC (Arm A), in combination with docetaxel in FGFR1 amplified metastatic sqNSCLC that has progressed after at least 1 line of chemotherapy (Arm B), or in combination with pemetrexed + cisplatin in patients with untreated and unresectable MPM (Arm C). Each arm involves a dose escalation phase utilizing the 3+3 design, followed by an expansion phase up to 30 patients (pts). Key endpoints include the MTD/MFD of GSK3052230 with chemotherapy, safety, response rates and duration.

      Results:
      Thirty-four pts have been dosed with GSK3052230 at dose levels ranging from 5mg/kg to 20mg/kg in combination with chemotherapy across three Arms, n=15 (A), n=6 (B) and n=13 (C). Baseline characteristics: males/females 29/5; mean age 68.5 years; ECOG PS 0 (n=20), 1 (n=13), 2 (n=1). Most common AEs were: Arm A: asthenia, neutropenia; Arm B: neutropenia, diarrhea, rash; Arm C: decreased appetite, nausea, infusion reaction. Infusion reactions were seen in 8/34 (24%) pts (n=3 Grade (Gr)1, n=3 Gr2, n=2 Gr3). Serious AEs included: Arm A- neutropenia (n=4), fatigue (n=1), asthenia (n=1), fever (n=1), respiratory infection (n=1); Arm B- neutropenia (n=1), abdominal pain (n=1); Arm C-bowel perforation/ischemia (n=1), infusion reaction (n=1), elevated creatinine (n=1). No DLTs have been observed in sqNSCLC pts (Arms A and B). Three DLTs were reported in mesothelioma pts (Arm C 20mg/kg): Gr5 bowel perforation/ischemia, Gr4 elevated creatinine levels and Gr3 infusion reaction. MFD for Arm A is determined at 20mg/kg. Dose escalation is ongoing for Arms B and C. Preliminary PK results revealed no drug-drug interactions. At time of data-cutoff, 10 PR were observed among 23 patients evaluable for efficacy (ORR = 43%) and a clinical benefit rate of 78% with two ongoing subjects on study >300 days. Preliminary efficacy is as follows: Arm A (6 PR, 2 SD, 1 PD, 6= not-yet-evaluable (NE)), Arm B (4 SD, 1 PD, 1 NE), and Arm C (3 PR, 3 SD, 3 PD, 4 NE).

      Conclusion:
      GSK3052230 is in general well tolerated in combination with chemotherapy. The MFD for GSK3052230 is 20mg/kg in combination with paclitaxel + carboplatin in first line sqNSCLC patients. Toxicities typically associated with small-molecule FGFR inhibitors, namely hyperphosphatemia and retinal, nail, and skin changes, were not observed. The initial activity and safety profile of GSK3052230 ​warrant further study.

      Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.

      Only Active Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login or select "Add to Cart" and proceed to checkout.

  • +

    ORAL 02 - PD1 Axis Immunotherapy 2 (ID 87)

    • Event: WCLC 2015
    • Type: Oral Session
    • Track: Treatment of Advanced Diseases - NSCLC
    • Presentations: 1
    • +

      ORAL02.03 - Longer-Term Follow-Up of a Phase 2 Study (CheckMate 063) of Nivolumab in Patients with Advanced, Refractory Squamous Non-Small Cell Lung Cancer (ID 828)

      10:45 - 12:15  |  Author(s): P. Paik

      • Abstract
      • Presentation
      • Slides

      Background:
      Patients with advanced, refractory squamous (SQ) non-small cell lung cancer (NSCLC) have historically poor outcomes and limited treatment options. Nivolumab (NIVO), a fully human IgG4 programmed death-1 (PD-1) immune checkpoint inhibitor antibody, has activity across NSCLC histologies and is FDA-approved for treatment of metastatic SQ NSCLC with progression on or after platinum-based chemotherapy. We report efficacy, safety, and biomarker analyses from a phase 2, single-arm study of NIVO in patients with SQ NSCLC who progressed during/after prior platinum-based doublet chemotherapy and ≥1 additional systemic regimen.

      Methods:
      Patients (N=117) received NIVO 3 mg/kg every 2 weeks until progressive disease (PD)/unacceptable toxicity; treatment beyond PD was permitted per protocol. The primary endpoint was independent radiology review committee (IRC)-assessed objective response rate (ORR), per RECIST v1.1. Additional objectives included investigator-assessed ORR, progression-free survival (PFS), overall survival (OS), safety, ORR by patient subgroups, efficacy by tumor PD-L1 expression (PD-L1[+]: ≥5% tumor cells expressing PD-L1), and blood-based biomarker analyses (measurement of circulating microRNA and cytokines).

      Results:
      IRC-assessed ORR was 15% (95% CI: 9, 22), with a minimum of 11 months follow-up. Median duration of response was not reached (range, 2+–12+ months); 76% (13/17) of patients had ongoing responses. Objective responses were observed across patient subgroups and regardless of PD-L1 expression (Table). Four of 22 patients treated beyond PD demonstrated a non-conventional pattern of benefit (ie, persistent reduction in target lesions in the presence of new lesions, regression following initial progression, or no further progression for ≥2 tumor assessments); OS for these patients was 6.6, 11.6+, 12.9+, and 13.5+ months. The 1-year OS rate was 41% (95% CI: 32, 50) and median OS was 8.2 months (95% CI: 6.1, 10.9). The 1-year PFS rate was 20% (95% CI: 13, 29); median PFS was 1.9 months (95% CI: 1.8, 3.2). Peripheral increases in serum IFN-γ-stimulated cytokines, including CXCL9 and CXCL10, were observed, and preliminary microRNA analyses identified altered gene expression following NIVO treatment. Grade 3–4 treatment-related adverse events occurred in 17% of patients, including fatigue (4%), diarrhea (3%), and pneumonitis (3%). Pneumonitis was manageable with corticosteroids; median time to resolution was 3.4 weeks (range, 0.7–13.4). Two treatment-related deaths (1 hypoxic pneumonia, 1 ischemic stroke) occurred in patients with multiple comorbidities and concurrent PD. Figure 1



      Conclusion:
      NIVO demonstrated clinically meaningful efficacy and an acceptable safety profile in patients with advanced, refractory SQ NSCLC. Updated 18-month OS, safety, and biomarker analyses will be presented.

      Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.

      Only Active Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login or select "Add to Cart" and proceed to checkout.

  • +

    ORAL 03 - New Kinase Targets (ID 89)

    • Event: WCLC 2015
    • Type: Oral Session
    • Track: Treatment of Advanced Diseases - NSCLC
    • Presentations: 1
    • +

      ORAL03.07 - Response to MET Inhibitors in Stage IV Lung Adenocarcinoma Patients with Mutations That Cause MET Exon 14 Skipping (ID 2764)

      10:45 - 12:15  |  Author(s): P. Paik

      • Abstract
      • Presentation
      • Slides

      Background:
      Mutations in the MET exon 14 RNA splice acceptor and donor sites, which lead to exon skipping, deletion of the juxtamembrane domain, and loss of Cbl E3-ligase binding to the resultant aberrant MET protein, were previously reported to be oncogenic in preclinical models (Kong-Beltran, Cancer Res 2006). These mutations occur in 4% of lung adenocarcinomas but have not been clinically assessed (TCGA 2014). We now report responses to the MET inhibitors crizotinib and cabozantinib in patients with stage IV lung adenocarcinomas harboring mutations leading to MET exon 14 skipping.

      Methods:
      Patients with stage IV lung adenocarcinomas harboring MET exon 14 splice site mutations (N=6) or a mutation deleting Y1003 in exon 14 (N=1) were identified through a clinical assay based on hybrid capture/next-generation sequencing of 341 oncogenes and tumor suppressors (MSK-IMPACT). MET IHC was performed on archival FFPE tissue. RNA skipping was confirmed by NanoString. Radiographic response to MET inhibition was assessed using RECIST 1.1 and PERCIST criteria.

      Results:
      Clinicopathologic data for those treated (N=4) are in the table below:

      ID Age Sex Smoking status (pack years) MET exon 14 variant MET therapy Response MET IHC (H-score)
      1 65 M C (20) MET p.V1001_F1007del (c.3001_3021delGTAGACTACCGAGCTACTTTT) crizotinib (3rd line) PR (-31%) NA
      2 80 M F (20) MET c.3024_3028delAGAAGGTATATT crizotinib (3rd line) PR (-30%) 300
      3 90 F N MET c.3028G>C crizotinib (3rd line) PR (-47%) NA
      4 80 F N MET c.3028G>C cabozantinib (3rd line) SD (0%), CR (PERCIST) 300
      To date, 3 patients have been treated with off-label crizotinib and 1 with cabozantinib (NCT01639508). Three of four patients (75%) developed a PR to treatment. The remaining patient had SD by RECIST, with PET imaging demonstrating a complete PERCIST response to treatment.

      Conclusion:
      MET exon 14 skipping is a novel oncogenic target that predicts for response to MET inhibitors. This appears to be a substantially better predictor of response than either protein expression or gene amplification. Patients with these splice site mutations should be treated on a clinical trial of a MET inhibitor. For those without access to a trial, use of off-label crizotinib should be considered.

      Only Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login, select "Add to Cart" and proceed to checkout. If you would like to become a member of IASLC, please click here.

      Only Active Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login or select "Add to Cart" and proceed to checkout.

  • +

    P2.03 - Poster Session/ Treatment of Locoregional Disease – NSCLC (ID 213)

    • Event: WCLC 2015
    • Type: Poster
    • Track: Treatment of Locoregional Disease – NSCLC
    • Presentations: 1
    • +

      P2.03-032 - Prognostic Impact of EGFR and KRAS Mutations in Patients with Lung Adenocarcinoma Treated with Definitive Radiation Therapy (ID 2422)

      09:30 - 17:00  |  Author(s): P. Paik

      • Abstract
      • Slides

      Background:
      An association of EGFR and KRAS mutations with radiation sensitivity has been postulated in preclinical studies. Recent clinical studies reported longer local control and survival in patients (pts) harboring EGFR mutations treated with definitive radiotherapy (RT). Here, we sought to evaluate the prognostic impact of EGFR and KRAS mutations in 223 adenocarcinoma pts treated with definitive RT at our institution.

      Methods:
      Between 2004 and 2013, 466 inoperable pts with non-squamous lung cancer were treated with definitive RT ± chemotherapy. Mutational testing was performed in 223 pts. 44% were male, 56% female. 65% were former, 13% never, and 22% current smokers. Clinical stage was II in 5%, IIIA in 37% and IIIB in 58%. Median size of tumor was 3.8 cm (range 0.5-12.2 cm). 60% received concurrent, 31% sequential chemo-RT and 9% RT alone. The median RT dose was 63Gy (range 50-80Gy). OS was estimated by the Kaplan-Meier method. Cumulative incidence functions were used to estimate local failure (LF) and distal failure (DF), using death without failure as a competing risk. Association of factors with OS was analyzed by Cox regression and association with LF and DF by competing risk regression.

      Results:
      EGFR status was wild-type in 205 pts (92%) and mutated in 18 (8%). The most common EGFR mutations were exon 19 deletion (8 pts), followed by exon 21 L858R (7 pts), and exon 20 insertion (3 pts). KRAS status was wild- type in 142 pts (64%), mutated in 63 (28%), and not performed in 18 (8%). The most common mutations were G12C (13%), followed by G12V (5%) and G12A and G12D (3% each). With a median follow-up among survivors of 32.7 months (range 0.6-114), the median OS was 38 months for pts with EGFR mutation versus 26 months for pts without (p=0.96); 21 months for patients with KRAS mutation versus 31 months for pts without (p=0.24). 2-year LF was 37% and 46% for pts with and without EGFR mutation, and 48% and 46% for pts with and without KRAS mutation, respectively. 2-year DF was 80% and 64% for pts with and without EGFR mutation, and 62% and 64% for pts with and without KRAS mutation, respectively. On univariate analysis, factors significantly associated with improved OS included KPS ≥ 80 (p=0.01), increasing RT dose (p=0.04) and use of concurrent chemotherapy compared to RT alone (p=0.001). Factors associated with higher risk of LF included stage IIIB (p=0.04) and sequential rather than concurrent chemotherapy (p=0.05). Factors associated with a higher risk of DM included stage IIIB (p=0.03) and lower RT dose (p=0.003). Association of EGFR and KRAS mutations did not reach statistical significance on univariate analysis, thus we did not further investigate their effects by multivariable analysis.

      Conclusion:
      Despite analyzing the largest patient population to date, we did not identify a significant prognostic impact by EGFR or KRAS mutational status. The lack of an observed association could be related to the low rate of EGFR mutations identified. RT dose and use of concurrent chemotherapy were significantly associated with overall survival.

      Only Active Members that have purchased this event or have registered via an access code will be able to view this content. To view this presentation, please login or select "Add to Cart" and proceed to checkout.

  • +

    P2.04 - Poster Session/ Biology, Pathology, and Molecular Testing (ID 234)

    • Event: WCLC 2015
    • Type: Poster
    • Track: Biology, Pathology, and Molecular Testing
    • Presentations: 1
    • +

      P2.04-050 - Basaloid Squamous Cell Cancers Arising from the Lung: Next Generation Sequencing Reveals PTCH1 Mutations in the Hedgehog Pathway (ID 3211)

      09:30 - 17:00  |  Author(s): P. Paik

      • Abstract

      Background:
      Basaloid squamous cell lung cancers are a defined variant of non-small cell lung cancers associated with a high mitotic count and rapid clinical progression. Due to its morphologic similarities with basal cell carcinoma of the skin, distinguishing between the two can be difficult. We sought to define the molecular characteristics of basaloid squamous cell cancers that were clinically defined as possible lung primaries in an effort to aid in the diagnosis of this disease.

      Methods:
      We reviewed a total of 179 patients who were diagnosed with squamous cell lung cancers and had undergone tumor next generation sequencing at Memorial Sloan Kettering. Through the MSK-Integrated Mutation Profiling for Actionable Cancer Targets (MSK-IMPACT), the illumina HiSeq platform was used to detect 341 potentially actionable genetic alterations, including single base substitutions, indels, copy number alterations and selected gene fusions. Data on clinicopathologic characteristics, smoking history were reviewed, and their mutational profile described.

      Results:
      A total of 6 of 179 (2%) patients with squamous cell lung cancers were found to have basaloid features. Of the 6 patients with basaloid features, 5 (83%) were men, 2 (33%) were never-smokers, 6 (100%) were white Caucasians, 3 (50%) had resected lung specimens, and 2 (33%) presented with stage IV disease. Three cases (50%) had protein patched homolog 1 (PTCH1) mutations in the hedgehog pathway (H652Y, V1057splice, V579fs), identical to those found in basal cell carcinoma of the skin. Two of these patients had a history of basal cell carcinoma of the skin, raising the possibility of metachronous metastatic basal cell carcinoma of the skin. One patient had no such history of basal cell skin cancer.

      Conclusion:
      Basaloid squamous cell cancers that appear to arise from the lung frequently harbor PTCH1 mutations. Metachronous metastatic basal cell carcinoma of the skin needs to be considered as a possibility in patients with a history of superficial skin lesions. Patients diagnosed with these basaloid cancers that harbor PTCH1 mutations, whether from skin or lung origin, may benefit from hedgehog pathway inhibitors such as vismodegib.

  • +

    P3.01 - Poster Session/ Treatment of Advanced Diseases – NSCLC (ID 208)

    • Event: WCLC 2015
    • Type: Poster
    • Track: Treatment of Advanced Diseases - NSCLC
    • Presentations: 1
    • +

      P3.01-075 - Phase 2 Trial of Bortezomib in KRAS G12D Mutant Lung Cancers (ID 2943)

      09:30 - 17:00  |  Author(s): P. Paik

      • Abstract

      Background:
      KRAS mutations are the most common oncogenic drivers in lung cancers without any approved targeted therapy. Preclinical evidence suggests that KRAS mutations are highly dependent on the NF-kB pathway. Bortezomib, a small molecule proteasome inhibitor, has been shown to downregulate the NF-kB pathway and lead to objective responses in patients with KRAS G12D in early phase clinical trials. In this single-institution, open label, phase II study we assessed the efficacy and safety of subcutaneous bortezomib in KRAS mutant lung cancers.

      Methods:
      Patients with advanced KRAS G12D mutant lung cancers were eligible. Bortezomib was administered at 1.3mg/m2/dose subcutaneously on days 1, 4, 8, and 11 of a 21 day cycle until disease progression or unacceptable toxicity. The primary objective was radiographic response rate (RECIST version 1.1). The secondary endpoints were progression free survival (PFS) and overall survival (OS) determined from the time of first bortezomib treatment. Simon two-stage minimax design was used (H0=10%, H1=30%, power=90%).

      Results:
      Sixteen patients with KRAS G12D mutant lung adenocarcinomas were treated on study: 44% women, 38% never smokers, 31% former smokers ≤15 pack years, and 69% with invasive mucinous adenocarcinomas. Patients received treatment for a median of 2 months (range 1-12months). One patient had a partial response with a 66% reduction in disease burden (6% observed rate, 95% CI 0.2 to 30.2%). Of the 6 patients (40%) with stable disease, 2 remained on study for over 5 months. The median PFS was 1 month (95% CI 1-6). The median OS was 13 months (95% CI 6-NA). The median OS from date of diagnosis of metastatic disease was 39 months (95% CI 35-NA). The most common treatment-related toxicities of any grade were fatigue (50%), diarrhea (38%), nausea (31%), and papulopustular rash (31%). Treatment-related peripheral neuropathy occurred in 25% of patients (3 patients with grade 1, 1 patient with grade 2).

      Conclusion:
      In patients with G12D KRAS mutant lung cancers, bortezomib was well tolerated and associated with modest anti-tumor activity and durable disease control in a small subset of patients. Further investigation into predictive biomarkers for the efficacy of bortezomib should be pursued. Without a clear biomarker, no further study of bortezomib in KRAS- mutant lung cancers is warranted.